Getting HuggingFace Transformers to work on AMD GPUs with ROCm
AMD GPUs are being rolled out in high-performance clusters across the world, including the new Setonix cluster at the Pawsey Supercomputing Centre in Perth. AMD GPUs don’t use CUDA, they use ROCm, and let’s say ROCm has not received as much attention as CUDA: not everything runs straight out of the box.
Here’s how I got ROCm to work with 🤗 HuggingFace Transformers on Setonix.
Installing everything
First, I use this alias for nicer work on the gpu-dev queue:
alias getgpunode='salloc -p gpu-dev --nodes=1 --gpus-per-node=1 --account=${PAWSEY_PROJECT}-gpu'
Notice the -gpu at the end of the account: currently Pawsey treats GPU jobs on a different account from your ‘main’ account.
I am using conda (mamba) on /scratch here. Pawsey staff doesn’t seem to be the biggest fan of conda as it makes many, many files per environment which slows down /scratch for everyone. It’s better to use Docker images. But with machine learning/deep learning libraries, especially with models stored on 🤗 Hugging Face spaces, I’ve always had to fight to get just the right ‘mix’ of package version numbers to make the model work: it’s easier to do that in conda first, then to build the Docker image from there.
I’m making a fresh conda environment somewhere on /scratch: (/software can also be used, but file limits are strict: check using lfs quota /software). The 30-day deletion policy will eventually get rid of this environment.
mamba create -p (somewhere on scratch)/transformers transformers python=3.10
conda activate (somewhere on scratch)/transformers
Now we need to install the right version of PyTorch. Just as there are CUDA-specific versions of PyTorch there are ROCm-specific version of PyTorch. At the time of this writing, Pawsey has two ROCm versions as modules:
(The following code is run in an interactive GPU session via the above getgpunode alias)
module avail rocm
tells us there’s 5.2.3 (default, D) and 5.4.3. Let’s load 5.4.3 because we live in the future:
module load rocm/5.4.3
We need to install a PyTorch version which is as close as possible to 5.4.3. I can only find 5.4.2 so let’s use that:
pip3 install torch torchvision torchaudio --index-url https://download.pytorch.org/whl/rocm5.4.2 --cache-dir (somewhere on scratch)/pipcache
Notice that I’m setting –cache-dir to somewhere on /scratch, too, as the default is in your home-directory and the file limits there are even stricter.
We can test whether PyTorch can see the GPU via ROCM:
srun python -c 'import torch; print(torch.cuda.is_available())'
This should print True.
Now we can install the right tensorflow for ROCm:
pip install tensorflow-rocm
Again, just like pip, Transformers puts its huge models into your home-directory leading to all kinds of errors as it hits the file number limits.
export TRANSFORMERS_CACHE=(somewhere on scratch)/tf_cache
For Transformers to work I also had to upgrade accelerate:
pip install -U accelerate
Now we should have everything in place to run Transformers. IMHO, the installation process wasn’t too bad, similar in pain to installing this stuff under CUDA. There are still some models on 🤗HuggingFace that I can’t get to run under CUDA… For both CUDA and ROCm it mostly boils down to using the correct index-url for torch and the right flavour of tensorflow.
Let’s train!
I was able to run the snippet of code on the bottom of the page for InstaDeepAI’s The Nucleotide Transformer model nucleotide-transformer-500m-1000g, but here’s my code to finetune this transformer and use it to classify some DNA:
import torch
print(torch.cuda.is_available())
import sys
from transformers import AutoTokenizer
from datasets import Dataset
from transformers import DataCollatorWithPadding
from transformers import TrainingArguments, Trainer, logging
from transformers import AutoModelForSequenceClassification
import pandas as pd
import numpy as np
from sklearn.metrics import f1_score, accuracy_score
import logging
from sklearn.model_selection import train_test_split
def import_data(csv_file):
"""
Import the csv file and get it ready for use. Ensures each file gets the same treatment.
in -> csv_file - string representing the location of the csv file
out -> pandas dataframe
"""
df = pd.read_csv(csv_file)
df.rename(columns = {'sequence': 'text'}, inplace = True)
return df
def preprocess_function(examples):
"""
Tokenize the text to create input and attention data
in -> dataset (columns = text, label)
out -> tokenized dataset (columns = text, label, input, attention)
"""
return tokenizer(examples["text"], truncation=True)
def pipeline(dataframe):
"""
Prepares the dataframe so that it can be given to the transformer model
in -> pandas dataframe
out -> tokenized dataset (columns = text, label, input, attention)
"""
# This step isn't mentioned anywhere but is vital as Transformers library only seems to work with this Dataset data type
dataset = Dataset.from_pandas(dataframe, preserve_index=False)
tokenized_ds = dataset.map(preprocess_function, batched=True)
tokenized_ds = tokenized_ds.remove_columns('text')
return tokenized_ds
f = sys.argv[1]
# Load train
train_val_df = import_data(f)
train_df, val_df = train_test_split(train_val_df[['text', 'label']],
test_size = 0.2, random_state = 42)
tokenizer = AutoTokenizer.from_pretrained("InstaDeepAI/nucleotide-transformer-500m-1000g",
num_labels = len(set(train_val_df['label'])))
tokenized_train = pipeline(train_val_df)
tokenized_val = pipeline(train_val_df)
model = AutoModelForSequenceClassification.from_pretrained("InstaDeepAI/nucleotide-transformer-500m-1000g",
trust_remote_code = True,
num_labels=len(set(train_val_df['label'])))
data_collator = DataCollatorWithPadding(tokenizer=tokenizer)
training_args = TrainingArguments(
output_dir=f"./results_{sys.argv[1].replace('.csv', '')}",
save_strategy = 'epoch',
optim="adamw_torch",
resume_from_checkpoint = True,
learning_rate=2e-5,
per_device_train_batch_size=32, # fiddle with this until it crashes
per_device_eval_batch_size=32,
save_total_limit = 2,
fp16 = True,
num_train_epochs=70,
weight_decay=0.01,
logging_steps = 20,
report_to="none",
)
trainer = Trainer(
model=model,
args=training_args,
train_dataset=tokenized_train,
eval_dataset=tokenized_val,
tokenizer=tokenizer,
data_collator=data_collator,
)
trainer.train(resume_from_checkpoint=True)
trainer.save_model(sys.argv[1] + '_' + 'MODELSAVES')
This script will read in a CSV of training data and write a trained model into a folder ending in MODELSAVES. The data looks like this:
sequence,label
ACCGCGGTTATACGAGAGGCCCAAGTTGATAGACTCCGGCGTAAAGAGTGGTTAAGATAAATTTTAAACTAAAGCCGAACGCCCTCAAAGCTGTTATACGC,0
After training, you can load the model and do some predictions:
model = AutoModelForSequenceClassification.from_pretrained(FOLDER_WE_SAVED_TO)
trainer = Trainer(model=model, tokenizer = tokenizer, data_collator=data_collator)
preds = trainer.predict(YOUR_DATA)
preds_flat = [np.argmax(x) for x in preds[0]]
print(preds_flat[:5])
This should print something like [0, 0, 0, 0, 0], the first five predicted labels.
How do you know that it’s actually using the GPU? Here’s some Python code that’ll tell you:
print(f'devices: {torch.cuda.device_count()}')
print(f'current dev: {torch.cuda.current_device()}')
print(f'current dev name: {torch.cuda.get_device_name(torch.cuda.current_device())}')
This prints out whether Python sees the GPU in the first place.
On Setonix, you can also ssh into the nodes that are running your jobs! Use squeue to see which node runs your job. They’re usually named like nid12345. After ssh-ing in, run rocm-smi to see the GPU usage on the current node.
Now we’re ready to train big, big models on a cluster with 192 GPU nodes, each with effectively eight GPUs (4 GPUs with 2 ‘Graphics Complex Dies’ (GCDs)). Happy training!
P.S.: Next we’ll have to package the above up in a Dockerfile - that’s for another day. No need to waste all that space on thousands of conda-generated files when we can just have one neat Docker-image.
P.P.S.: See the Pawsey documentation for more detailed info, especially some useful SLURM scripts and ways to run several GPUs at once.
P.P.P.S.: Some errors I encountered:
python3.10/site-packages/torch/lib/libtorch_cpu.so: undefined symbol: roctracer_next_record, version ROCTRACER_4.1 - this one is funny, at the time of this writing there are no results on Google for this error. Tells you how much AMD is used in production! For me this happened when I installed the wrong PyTorch version for the wrong ROCm. Make sure the index-url’s ROCm version is close to the ROCm loaded by Setonix, and that you’re loading the right module version.
Device-side assertion t >= 0 && t < n_classes’ failed. - in my training data, I started my class labels with a random large number instead of zero. I replaced class-labels all by a counter starting from 0.